|
|
vectorstrip |
vectorstrip is suitable for use with low quality sequence data as it can allow for mismatches between the sequence and the vector patterns provided. You can specify the maximum level of mismatch expected.
Vector data can either be provided in a file or interactively. If presented in a file, vectorstrip will search all input sequences with all vectors listed in that file. The intention is that the user can maintain a single file for use with vectorstrip, containing all the linker sequences commonly used in the laboratory.
The two patterns for each vector are searched separately against the sequence. Once the search is completed, each of the hits of the 5' sequence is paired with each of the hits of the 3' sequence and the resulting subsequences are output. For example, if the 5' sequence matches the sequence from (a) position 30-60, and(b)position 70-100, and the 3' sequence matches from 150-175, then two subsequences will be output: from 61-149, and from 101-149. The lower the quality of the sequence, the more likely multiple hits become if nonzero mismatches are accepted.
Default behaviour is to report only the best matches between the vector patterns and the sequence. This means that if you specify a maximum mismatch level of 10%, but the vector patterns match the sequence with zero mismatches, the search will stop and the program will output only these "best" matches. If there are no perfect matches, the program will try searching again allowing 1 mismatch, then 2, and so on until either the patterns match the sequence or the maximum specified mismatch level is exceeded. You can tell vectorstrip to show all possible matches up to your specified maximum level, as illustrated in the examples below.
% vectorstrip @../../data/vecseqs.list Strips out DNA between a pair of vector sequences Are your vector sequences in a file? [Y]: Name of vectorfile: ../../data/vectors Max allowed % mismatch [10]: Show only the best hits (minimise mismatches)? [Y]: Output file [pbluescript.vectorstrip]: vector.strip Output sequence [pbluescript.fasta]: vector.fasta |
Go to the input files for this example
Go to the output files for this example
Mandatory qualifiers (* if not always prompted):
[-sequence] seqall Sequence database USA
[-[no]vectorfile] boolean Are your vector sequences in a file?
* [-vectors] infile Name of vectorfile
-mismatch integer Max allowed % mismatch
-[no]besthits boolean Show only the best hits (minimise
mismatches)?
* -linkera string 5' sequence
* -linkerb string 3' sequence
[-outf] outfile Output file name
[-outseq] seqoutall Output sequence(s) USA
Optional qualifiers: (none)
Advanced qualifiers: (none)
Associated qualifiers:
"-sequence" related qualifiers
-sbegin1 integer First base used
-send1 integer Last base used, def=seq length
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sopenfile1 string Input filename
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outf" related qualifiers
-odirectory4 string Output directory
"-outseq" related qualifiers
-osformat5 string Output seq format
-osextension5 string File name extension
-osname5 string Base file name
-osdirectory5 string Output directory
-osdbname5 string Database name to add
-ossingle5 boolean Separate file for each entry
-oufo5 string UFO features
-offormat5 string Features format
-ofname5 string Features file name
-ofdirectory5 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for required and optional values
-debug boolean Write debug output to program.dbg
-acdlog boolean Write ACD processing log to program.acdlog
-acdpretty boolean Rewrite ACD file as program.acdpretty
-acdtable boolean Write HTML table of options
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report deaths
|
| Mandatory qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
| [-[no]vectorfile] (Parameter 2) |
Are your vector sequences in a file? | Boolean value Yes/No | Yes |
| [-vectors] (Parameter 3) |
Name of vectorfile | Input file | Required |
| -mismatch | Max allowed % mismatch | Any integer value | 10 |
| -[no]besthits | Show only the best hits (minimise mismatches)? | Boolean value Yes/No | Yes |
| -linkera | 5' sequence | Any string is accepted | An empty string is accepted |
| -linkerb | 3' sequence | Any string is accepted | An empty string is accepted |
| [-outf] (Parameter 4) |
Output file name | Output file | <sequence>.vectorstrip |
| [-outseq] (Parameter 5) |
Output sequence(s) USA | Writeable sequence(s) | <sequence>.format |
| Optional qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced qualifiers | Allowed values | Default | |
| (none) | |||
../../data/bluescript.seq ../../data/litmus.seq ../../data/pTYB1.seq |
# Example vector file for use by vectorstrip # Vector 5' 3' pTYB1 GACGGCGGCCGCGAATTCC TCGAGGGCTCTTCCTGC pBS_KS+ GGGTACCGGGCCCCCCC TCGAGGTCGACGGTA pLITMUS GATATCCTGCAGGAATTCC TCGAGACCGTACGTGCG |
The same fragment has been cloned into the XhoI site of the polylinker of each vector. The cloned fragment is represented in lower case and the vector sequence in upper case so the sequence trimming can be readily seen.
Each line of the vector file should contain the name of the vector, the
5' pattern and the 3' pattern.
Lines beginning with # are treated as comments and ignored.
If only one vector sequence is given in the it will be assumed that
this is the 5' pattern.
If a vector name is given but no pattern data, the vector will not
be used.
>pBlueScript_from_84_to_204 KS+ tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag c >litmus.seq_from_62_to_182 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag c >pTYB1.seq_from_59_to_179 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag c |
Sequence: pBlueScript Vector: pTYB1 No match Sequence: pBlueScript Vector: pBS_KS+ 5' sequence matches: From 67 to 83 with 0 mismatches 3' sequence matches: From 205 to 219 with 0 mismatches Sequences output to file: from 84 to 204 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca cacagtgacatgagagacacagatatagagacagatagacgatagacaga cagcatatatagacagatagc sequence trimmed from 5' end: GGAAACAGCTAATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACT AAAGGGAACAAAAGCTGGGTACCGGGCCCCCCC sequence trimmed from 3' end: TCGAGGTCGACGGTATCGATAAGCTTGATATCG Sequence: pBlueScript Vector: pLITMUS No match Sequence: litmus.seq Vector: pTYB1 No match Sequence: litmus.seq Vector: pBS_KS+ No match Sequence: litmus.seq Vector: pLITMUS 5' sequence matches: From 43 to 61 with 0 mismatches 3' sequence matches: From 183 to 199 with 0 mismatches Sequences output to file: from 62 to 182 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca cacagtgacatgagagacacagatatagagacagatagacgatagacaga cagcatatatagacagatagc sequence trimmed from 5' end: TCTAGAACCGGTGACGTCTCCCATGGTGAAGCTTGGATCCACGATATCCT GCAGGAATTCC sequence trimmed from 3' end: TCGAGACCGTACGTGCGCGCGAATGCATCCAGATCTTCCCTCTAGTCAAG GCCTTAAGTGAGTCGTATTACGGA Sequence: pTYB1.seq Vector: pTYB1 5' sequence matches: From 40 to 58 with 0 mismatches 3' sequence matches: From 180 to 196 with 0 mismatches Sequences output to file: from 59 to 179 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca cacagtgacatgagagacacagatatagagacagatagacgatagacaga cagcatatatagacagatagc sequence trimmed from 5' end: CTTTAAGAAGGAGATATACATATGGCTAGCTCGCGAGTCGACGGCGGCCG CGAATTCC sequence trimmed from 3' end: TCGAGGGCTCTTCCTGCTTTGCCAAGGGTACCAATGTTTTAATGGCGGAT Sequence: pTYB1.seq Vector: pBS_KS+ No match Sequence: pTYB1.seq Vector: pLITMUS No match |
Two types of output file are produced:
No suitable vectors found - exitingindicates that the 5' and 3' patterns for the vectors were blank - usually this is as a result of an empty vectorfile.
Illegal patternindicates that one of the vector patterns could not be compiled and therefore cannot be searched.
5' and 3' sequence matches are identical; inconclusiveindicates that the 5' and 3' patterns provided were identical, and that they only match the sequence once. Thus the program cannot determine which part of the sequence is vector and which is insert.
| Program name | Description |
|---|---|
| biosed | Replace or delete sequence sections |
| cutseq | Removes a specified section from a sequence |
| degapseq | Removes gap characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Reads and writes (returns) flatfile entries |
| extractfeat | Extract features from a sequence |
| extractseq | Extract regions from a sequence |
| listor | Writes a list file of the logical OR of two sets of sequences |
| maskfeat | Mask off features of a sequence |
| maskseq | Mask off regions of a sequence |
| newseq | Type in a short new sequence |
| noreturn | Removes carriage return from ASCII files |
| notseq | Excludes a set of sequences and writes out the remaining ones |
| nthseq | Writes one sequence from a multiple set of sequences |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsplit | Reads and writes (returns) sequences in individual files |
| skipseq | Reads and writes (returns) sequences, skipping the first few |
| splitter | Split a sequence into (overlapping) smaller sequences |
| trimest | Trim poly-A tails off EST sequences |
| trimseq | Trim ambiguous bits off the ends of sequences |
| union | Reads sequence fragments and builds one sequence |
| yank | Reads a sequence range, appends the full USA to a list file |